Class TestCasesStructuralDel


  • public class TestCasesStructuralDel
    extends TestCasesBase
    Test case Gene: geneId1 1:957-1157, strand: +, id:transcript_0, Protein Exons: 1:957-988 'exon_0_0', rank: 1, frame: ., sequence: gttgcttgaatactgtatagccttgccattgt 1:1045-1057 'exon_0_1', rank: 2, frame: ., sequence: tgtgttgctaact 1:1148-1157 'exon_0_2', rank: 3, frame: ., sequence: agacatggac CDS : gttgcttgaatactgtatagccttgccattgttgtgttgctaactagacatggac Protein : VA*ILYSLAIVVLLTRHG?

    1 0 1 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567890123456789012345678901234567 gttgcttgaatactgtatagccttgccattgt........................................................tgtgttgctaact..........................................................................................agacatggac V A * I L Y S L A I V V L L T R H G 01201201201201201201201201201201 2012012012012 0120120120 >>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>-------------------------------------------------------->>>>>>>>>>>>>------------------------------------------------------------------------------------------>>>>>>>>>> | | | | | | | | | | | ^1157 | | | | ^1148 | | | ^1057 | | ^1045 | ^988 ^957

    Gene: geneId2 1:2066-2141, strand: +, id:transcript_1, Protein Exons: 1:2066-2069 'exon_1_0', rank: 1, frame: ., sequence: actt 1:2084-2089 'exon_1_1', rank: 2, frame: ., sequence: cccttt 1:2116-2126 'exon_1_2', rank: 3, frame: ., sequence: tacgcccacgt 1:2133-2141 'exon_1_3', rank: 4, frame: ., sequence: ccgccgctg CDS : acttcccttttacgcccacgtccgccgctg Protein : TSLLRPRPPL

    1 7 8 9 0 1 2 3 4 6789012345678901234567890123456789012345678901234567890123456789012345678901 actt..............cccttt..........................tacgcccacgt......ccgccgctg T S L L R P R P P L 0120 120120 12012012012 012012012 >>>>-------------->>>>>>-------------------------->>>>>>>>>>>------>>>>>>>>> | | | | | | | | | | | | | | | ^2141 | | | | | | ^2133 | | | | | ^2126 | | | | ^2116 | | | ^2089 | | ^2084 | ^2069 ^2066

    • Constructor Detail

      • TestCasesStructuralDel

        public TestCasesStructuralDel()
    • Method Detail

      • checkEffects

        protected void checkEffects​(Variant variant,
                                    EffectType[] expEffs,
                                    java.lang.String[] expHgvsp,
                                    java.lang.String[] expHgvsc,
                                    VariantEffect.EffectImpact expectedImpact,
                                    java.lang.String[] expAnns)
      • test01_delGene

        @Test
        public void test01_delGene()
        Deletion Whole gene / whole transcript
      • test01_delTr

        @Test
        public void test01_delTr()
        Deletion Whole gene / whole transcript
      • test02

        @Test
        public void test02()
        Deletion One coding exon
      • test03

        @Test
        public void test03()
        Deletion two coding exons (within the same gene)
      • test04

        @Test
        public void test04()
        Deletion Part of one coding exon
      • test05

        @Test
        public void test05()
        Deletion Part of two coding exons (within the same gene)
      • test06

        @Test
        public void test06()
        Deletion one genes and part of another gene
      • test07

        @Test
        public void test07()
        Deletion after gene's coding region (LOW impact)
      • test08

        @Test
        public void test08()
        Deletion Part of two genes cutting on introns
      • test09

        @Test
        public void test09()
        Deletion Part of two genes cutting exons
      • test10

        @Test
        public void test10()
        Deletion Intron